BQ622987

Overview
NameBQ622987
Unique NameBQ622987
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length671
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3 contig Csv1_Contig3:1..671. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_00078 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00078 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ622987 ID=BQ622987|Name=BQ622987|organism=Citrus sinensis|type=EST|length=671bp
GCCGGTACAGTTAATGTCTTTGAAGATATCTCGCCTGAGAAGGCTCAGGC
TATTATGCTATTAGCTGGTAATGGTTCCTCCATTGCTCCAACAATGGCGC
AACCAAAAGTTCAGGTCCAGGCACCTAGCTCAAAGCCAACAACTGTTGAT
GGTGTTACTGGGAACCACCCTGTAAGCACCCCACCTGGCACTGGTCGTTC
AAGCCCTATATCTGTTTCTTCTCATACTGGTACTCAGTCAGCGAGTGGCT
CTACTAGTACTGAAGAACCAATGGCTGCTAAAACAATAGGGTTGACGACC
ACTCATATTTGCAAACCGGAGACTCCAAATATGGAGAAGGCAGTGGGATC
TGTTGCTGCAACTGCTGTGACATCTGCTGGACATTCAAACTTTTACAAGG
GCATCCCTCAGGCTCGAAAAGCTTCCTTGGCTCTATTTTTGGAGAAACGC
AAGCAAAGAGTGATGACCGTAGCCCCATACACCATCAACAAAAAGTAGTC
TCCAGAAGGCTCGGTTCTGGAATGCAATGGCTTTAACCACTCTGTAACCT
CGGCAGCATCAATTGATGGTAGCCGAGATAAAATAGCGCCGAACTAGAAG
GGTAATTTTGCAAATTTATGTAGTATGTTTTAATATTTAAGAAAATGGGT
TTTTTGTTCTTAAAAGGAACT
back to top