BQ622994

Overview
NameBQ622994
Unique NameBQ622994
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length668
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
BQ622994_ssr5 microsatellite BQ622994_ssr5:5..16. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig4 contig Csv1_Contig4:1..670. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_00085 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00085 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ622994 ID=BQ622994|Name=BQ622994|organism=Citrus sinensis|type=EST|length=668bp
AGATGAAGAAGAAGAATTTGAAGTTCCCACTTGCCCTTCTCTGCCCAAAC
TTCAAGTAGCTGGAAAACCACGCATTGATCTTGTGGCCGTCAAGCTTCCT
TGCATCAAGTTAGGGACGTGGTCAAGAGATGTGGCCCGTTTGCACTTGCA
GCTTGAAGCGGCTAGGATTGCTTCCTCTTCTAAGGGTCTTCATCCAGTGC
ATGTGCTTTTGGTGACTGAGTGCTTTCCAATCCCGAATCTCTTCACTTGC
AAGGACATTGTGGTACGTGAAGGAAATGCATGGCTATACAAACCCGACCT
CCATAGGTTGAGAGAAAAGCTATTGCTCCCTGTGGGATCATGTGAACTTG
CTGTTCCTCTTAAGGCTAAAGATATGTTTGAACAGAGAATTTCTACTCGG
AAAGGGCTCGACGGGAAGCATACGCAACCATCCTTCATTCTGCACATGTA
TATGTTTGTGGGGCCATTGCTGCAGCTCAGAGTATCCGCATGGCAGGTTC
AACACGAGATCTTGTGATACTTGTTGATGAAACAATTAGTGACTATCACA
GAGGTGGCTTGGAGGCTGCAGGCTGGAAAATCCATACAATCCAAAGAATC
AGGAACCCAAAAGCTGAACGCGATGCATACAATGAATGGAACTACAGTAA
ATTTCGTCTCTGGCAGTT
back to top