BQ623008

Overview
NameBQ623008
Unique NameBQ623008
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length415
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Alignments
Feature NameTypeLocationAnalysis
BQ623008_ssr356 microsatellite BQ623008_ssr356:356..367.
Csv1_Contig2188 contig Csv1_Contig2188:74..488. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUSDA-FP_00099 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00099 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623008 ID=BQ623008|Name=BQ623008|organism=Citrus sinensis|type=EST|length=415bp
TTTGAAGAATATGGAAGCTGTTTTTGCAGGTAAGAACCAATGGTCAGAGA
TGTTTGTTATGAAGGAGGGTGTTGATATTTGGCCGTATTGGGATAGTATT
CTTGCTGATGAGATAAGAAATGATAATCTTGATCTTCTTGAAGTTCCTCA
ATACGGGCGAAACCTTAATGAGACTGGTTGATTGGCTAAATACGAGTTGC
TTTATGTTGAGTAATGTTATGCTTTCAAGAGTTTGTATTTCATAAACAAA
GTGTGGATTTGGTACCTCAAAATGCAATTTTATATCACTTTGCATGAAAG
ACATATATGAAATACGTAGTATTTAATAAATAAGCATAGCGTTACTCTTC
TGTATTAAATAAATAAAAGACTTGTACTATTGCCAGCAGTTTAATTCAAT
AAATAAGATGATCTC
back to top