BQ623009

Overview
NameBQ623009
Unique NameBQ623009
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length596
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
Properties
Property NameValue
Genbank descriptionUSDA-FP_00100 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00100 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623009 ID=BQ623009|Name=BQ623009|organism=Citrus sinensis|type=EST|length=596bp
AAAAGGTTAATTATTAGTTCAGTCACCAATGGCTCTCAAAAATTTGTTTC
TCATCATTTTGTTTCTGATAACAAGTCTCGTTGCAAATGCAAGTGCCATG
AATAAGCCAGCTAGCTACAATATTAAAGAAGGGCTTCAAGCCAGTGGAGG
GCCTGGAGGCCAGTTCAATGAGTGCTTGAAGGCATATCAAGAATTGAACA
AATGCTTGGCCGTGATTTACCAATTCTTCTTTACTGGCATGACCAATGTT
GGTCCCTGCTGCGGAGCCATCGAAAACGTCACAAGAAAATGCGCCTGGCC
TAGCACTCTTCCTTGGTTCGGATACACACCCCAGCAAAGCAACATACTCT
TGAGCTACTGTCGTGCAATTTCTCCTGCTCCCTCTCCAGCTCAAGCTTAA
TTAATTCTCTGCTGCTTCTGCCGCTTCTTCAGTTTCAAGGGCCTTGTCTT
GTGTTGTTGATCTATGTGTGCTTGTTGCGTATAGTGTGAATTCAGAAGTC
TTTCTTTTATATATGGTTTTTATTTGGAGAAAGTCTTTTGCTGTGGATTG
TCTGTACGAATAAAAAGTTATACTTGCTTAAAAAAAAAAAAAAAAA
back to top