BQ623010

Overview
NameBQ623010
Unique NameBQ623010
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length474
Alignments
Feature NameTypeLocationAnalysis
BQ623010_ssr259 microsatellite BQ623010_ssr259:259..270.
Csv1_Contig13227 contig Csv1_Contig13227:40..513. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00101 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00101 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623010 ID=BQ623010|Name=BQ623010|organism=Citrus sinensis|type=EST|length=474bp
CTTGCAACAAGAAGCTGCCGGCATCTCCCACACAAGCTTGAAAAAGTAGC
CAGTAAGAGTTGTGCACGGGGGAAAGAAAAAAAGGGAAATAATAATGTGA
TGGGATTGGCAGGTGGTGTCTTAGCAGCGATCATAGTTATGATGATACTC
TTCTTCACCGCGGATCAATCTTGTGCAGCAGGCAACGGCACCACCATTAC
TAATTTCGATATTGATCCTGATGTGTTGTTCTTTTATGATGATCCGGAAT
CGGAATTGGCTGCTGCTGCTGCAACAAACGTATTGAATATGAAATCCTTG
AAGCGGCCTCCGGTGTTCAATTGCGGAAGAGGCCGAAGCAATCGCAAGTG
TACCCCTCCTCCCCAGGGTTCCAAAAAGGGTGAACATTGCCCACCTACGG
TTTTGTACAATCGAGGGTGCCAACATTAAGCCTTAAGTTTGTACTGCTGC
ATCCGTGCATATGCATTAATAAAT
back to top