BQ623029

Overview
NameBQ623029
Unique NameBQ623029
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length305
Alignments
Feature NameTypeLocationAnalysis
BQ623029_ssr295 microsatellite BQ623029_ssr295:295..304.
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00120 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00120 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623029 ID=BQ623029|Name=BQ623029|organism=Citrus sinensis|type=EST|length=305bp
AACTTAATTGCTTTTGTGTTTTGGTTACGGTTACCATAAGCGAGTAGAGA
TCTTTTGTGATTACCTTGAAGAACATGAAAACTCCTTGCGCAGGTTTGTC
GGCTAACTCCAGGTAATAACAATTGGTTTGAGGGGGTCCCTCAAATGTGG
CAGGCCGGTATTGTTGATGGGGAGAATGTGAACGATAATCTCGATTTTCT
TGTTGTTCCTCAATATGGAAGAAATCTTGATTACATTGGTTAAGTGTATG
AAATATTATTTTTATTTTTATGTGTAATAAAATAAGAATATGGATGTGTG
TGTGT
back to top