BQ623031

Overview
NameBQ623031
Unique NameBQ623031
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length287
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12425 contig Csv1_Contig12425:576..863. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00122 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00122 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623031 ID=BQ623031|Name=BQ623031|organism=Citrus sinensis|type=EST|length=287bp
GATTTGACAACAAGCGTCAAGTGCAGTGCATCAGTTTCCTTGCTGCCAAG
CCACCAGGCGTCTAGGTTCCCAATTAAATTTGTGTAACCACCCATGCAAT
ATTGTTGATTATTATTATGTGTAACCCCCATAATGATCATTCGATCAATG
GGGGTTCGGTTTGCGTTTAATTTGTACTTAGGCTGCTGTTGCTGCTGCTC
AAACTTTTTTGGTTTTCTCCCCGACTTTGGCTTTTTTTTTTTATATATAT
TTTAATAATTGAATCCTTTGTTTTCAGTTTAAAAAAA
back to top