BQ623032

Overview
NameBQ623032
Unique NameBQ623032
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length614
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00123 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00123 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623032 ID=BQ623032|Name=BQ623032|organism=Citrus sinensis|type=EST|length=614bp
CTGCGAGGGGAGGAGGCAAAGCAGCTATGGCGGCAATGAAGGGCGCCGGC
GGCCTCAAATTGCAGGCTGCTGCTTCTTCTTCCAAAGCTCAAGCCAAAGC
CAAAGCCAAAGGCAAGACCAAATCTGTAGCACCCTCCTCTACTTCTGAGT
TGGGCAGATTTCTGAACATCCCCGAGCCTCCCCGTTCCGAAACTGCTAAA
CTGATCACCAAGTTCATCAAACTCAACAATCGCGAGAACCCCGGAATGAA
AAAGGATCTTCTTGGTGAAGAGAAGTTGAAGTCTTTATTGTCTGGAAAAG
ATAGGATTGGGATCCCAGAGATTGCCAAATTGCTGTCCGGACAATTTGTG
AAAACTGGCTCTGGCTGATAGTTTGCTGCTATTATAATTGTGGTTGTAGT
TCTATTGTGCTGCAGAAACCAAATAATGTCTCATATTGTTAGTTAGGGAT
TTGTTCATGGGTTGAATATTTATTTCATTGAGAACTGCTGAATCATGGCA
AGAATGATATGCGAGAGATGTGCTGTTTATCTTTAAAAAAAAAAAAAAAA
AATAAAAAATTCATCTACCCAAAAAACCCAAAGTTGCCCCCCCCCCCCCA
TTTCCCATAAACAA
back to top