BQ623033

Overview
NameBQ623033
Unique NameBQ623033
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length654
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00124 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00124 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623033 ID=BQ623033|Name=BQ623033|organism=Citrus sinensis|type=EST|length=654bp
GTGATAATTCAAACTCCATAATGTTGGTGGATAATGCCTCTGAGTCAAAG
GAACAGCCAAAGGAAAATGTCATAGCCAGTGATGGTGTTAATCCTGCTGC
TAGAAATTTTGATCTGAATGCTGATTTAGATGAGAATGTGGACACAAAGA
CTGCAGCTCCTGCAGCACCAACCCAACCCTCATCAGCAGGGCCTTCTGAG
GAGACCAAACATGAAGAATATCCAGGTTGGTCTCTTTCGGAAATGGATAG
GATGGCCATCGACCCTCTTCAGATTGCAAACCTCAGCAGAAGGATAGATG
AGGAAGAGGAAGATTACGATGAAGAAGGGTAATTATGAAGTCAAGGCTTC
GCAAGAAGGTTAGTCATTCAGATCAGATTAATGTGTAGTAGACAGACAAG
AGAAAGACACAACGTAGTTGCAAGCATAGCGATGGCCTACAAGACAGAGA
ATGAATATACGCTCTCCGTAGTTCTCCTTAGAAATGGCGGCTATGTTTTA
TCTCTCTCTTTTCCTTCTGGTTCTTTGCCACCTTGCGAATTTTATTTGAT
ACCATTTTCTAACTACCTTTTCCATAACTAGACTTGCACTAGATTTATGC
ACTTCAACTATGTAATGTAGCAGGAAATTGGCAGCCTTGCTAGTAGTAAA
TCTT
back to top