BQ623035

Overview
NameBQ623035
Unique NameBQ623035
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length397
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3799 contig Csv1_Contig3799:1167..1558. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00126 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00126 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623035 ID=BQ623035|Name=BQ623035|organism=Citrus sinensis|type=EST|length=397bp
AGCCAGCAGAAATCGTTTGCCTTCCTGATTTGAAGATTATGGGAACTCCT
TGCGCAGTTTTATAACATGAATTTTTCAGGTTATACCGATTGGTCGGAGG
GGCTTATAGCCACAACTTTTTCACTTATTGCTGATGATGAAATTAATGGA
AATATTGATCTTCTTGTGGTCCCGCAATATGGAAGAAACCCTGATCACAC
TGGTTAAGAATATGCAGTATTAGTCTCTTATGTTATGTTTAAGAAAATAA
AAGTATGGGTACTGTTATTACCCGTCAATTGTATGATGGTCTCAATTTGG
TTCAATTTAACTTGTAAGATCTCTTGATATATATAAGAGATTCTCTTTGT
CTAGCTATTTATGTGTACCATGTTTTCCTAAAAGAAAAATAAAAAAA
back to top