BQ623039

Overview
NameBQ623039
Unique NameBQ623039
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length357
Alignments
Feature NameTypeLocationAnalysis
BQ623039_ssr27 microsatellite BQ623039_ssr27:27..40.
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00130 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00130 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623039 ID=BQ623039|Name=BQ623039|organism=Citrus sinensis|type=EST|length=357bp
CCACAAGCCACCTAAACTTTTCACAACTCTCTCTCTCTCTTTCGCTTTGT
GACTGTTACTCGTTTGTCAACCACAATCCACTGTCGCAACTCTCTCTTTC
CGTGCCCAAAATTGACTGTTGCTCTGCCTCTGCTATTGTTGCTCCATCTC
TGCTCAGTCTCAACTCTCAACTACTGCTGCTGCTTTTTGCTTTGTCTCTA
CTTCATCTCTACTCGCTAGTATTATTCCTCAATTTTTCTATCTGGGTAAG
TTGTGATGGTGGTTCTTCGCGTTTATTTTAGACCCAATTAATCATATTCG
TAGAATTTGTTAATGCTAACACTAAAAATAATTATCATGTAATTTTTGAA
AATTATT
back to top