BQ623051

Overview
NameBQ623051
Unique NameBQ623051
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length607
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1337 contig Csv1_Contig1337:547..1153. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00142 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00142 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623051 ID=BQ623051|Name=BQ623051|organism=Citrus sinensis|type=EST|length=607bp
CTTCTAATCAGCAAAGCAGTGCGGACTTTGCTAATAGAATGCAATATACT
GTAATGGAACGGCCTGCTCCGGCATCATTGCCCAATGAAGTTGACTGGCA
CAACCGGGGTTATAGGCCTAAGCAGCAAGAAGCGTACAGTAGGCAGCATG
ATCTACCGTACAAGAGAGATGGGTATAGTGAGGCTGAAACTATGCAACTT
CTCAGCCAAACCCATCTTCAGTCACCAGCTTCATCATCGCTCAATAAGTC
CAGTGAGATGCAAAGATATGAGCAATTCAGGAGATCTGGTGAATCCCATT
TGCTACATATGGTTCCCCCACAATGTAACCAATCAAACTATCAAGTAGAC
TCATCAGTTAACCCCAGGCACAGGCAGCAGTAAGAGAGGCCGAATTGGGA
ATGAACTTTCACTGTCAACAAATGATCATCATCAACAATGGCAATCTGGT
CCTCATATGTTTGCAACTGCTGCAGCATCATCAGGATTCCCTCAGCAGAT
TAGATCCTCTCACTCTCAGAATTGGCTGCAGAATAATGGATTCCACTCCC
TTGGTAGACCCTCCTAAGAATATGGCATAATGATCGGCTAATCTCTCATT
TCCTTCA
back to top