BQ623053

Overview
NameBQ623053
Unique NameBQ623053
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length618
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00144 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00144 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623053 ID=BQ623053|Name=BQ623053|organism=Citrus sinensis|type=EST|length=618bp
GACGGTGCAGCTTCCAAAGGGAGAAGACAAGTAAGATAGAGGCCGGGCCA
GCAGTTGGGTATCACCGGGCAAGGCTTGACCGTGGTGGAGGTTTGTTTCA
ATTTGAAGAGGCAAATGGAGATTTTGCAAAGTGAAAATGGGTTGCTGAAG
AAAGCTGTGGAGGATCTGAGGCGGGAAATTCTTGACGGGAAATCGAATCC
GTTTAATGGGGATTTGAATTCCGGGAAATATCGAGAATTTGAGAGAAATG
GAAATAATAAAGCTTCGAATAATAGAAATGATCGGCGAAATGGTGAGAAG
AAATCAATGGAAAGTGATGTGAATGAGGAGTTAAAGAGAGCGCTGAAGGG
AGATTCTGGTGGCGCTTAAGCTAGTCGAACGGCTTGTTATGTTTTGTATT
AAAAAAGTAATGTAGATTTCGTTTTCTTTTGGCTTGTACTGTTTTTGTTG
GTTTTATTAGATGTTTGTGAATTTGCTCTAATTATTCACAAAAATGGGAA
ATTTTAGTGTACATTAGTGCTTAAACGTGGAAACTAGATTTTGATCCCTT
GAATAAGAAGAATTCATGATGAATTTTTTTTTTACAAAAAAAAAAAAGAA
AATAAAAAAAAACCCTCC
back to top