BQ623085

Overview
NameBQ623085
Unique NameBQ623085
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length549
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2557 contig Csv1_Contig2557:187..734. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00176 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00176 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623085 ID=BQ623085|Name=BQ623085|organism=Citrus sinensis|type=EST|length=549bp
TAGATATAGGTTGATACATAAGTTGCTTTTTCTTCGGACTCGGCTATGGC
CTCTCATGGTAGCATCAAAGTTAGCACTACCACCTCCCCAAAAGGTGGCA
AGAGTACTACTTGATCCTCACGGCGGCGGTGCCGGTTCACCGAAAGGGCA
GTGCCTGTGTTCGCCGACGACTCACCAAGGGTCGTTCCGGTGCAGATTTC
ATCGGACGGCTGCAGGAGGGTCATCGGCGGCTTGGATCATGAAGCGATCA
AACTCCATGCCTGCCGATAAATCAGCAGCGGTGGCTTCTTTTTCTCCCAA
GTCAGTTGAGACTTGACCGCGCCTATTCCATGTAAGCTAAAGATTAATTA
ATGGCAGCTAGCTGCTTCTTCATATATATCTTTCAAAGCTCTGTAAAAAA
AAACAATATGTAATAGCTTTGATACTTGACTTTATATGTTTCTGCTTGGG
ATTTTCAATGCTTGAAACTGTTAAAACTCGTTCTTGATAATAGCCTATAG
GCAGCCCGCGGCTGGTATGTAAAATTAAAAAAAAAAAAAAAAAAAAAAC
back to top