BQ623091

Overview
NameBQ623091
Unique NameBQ623091
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length397
Alignments
Feature NameTypeLocationAnalysis
BQ623091_ssr374 microsatellite BQ623091_ssr374:374..385.
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00182 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00182 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623091 ID=BQ623091|Name=BQ623091|organism=Citrus sinensis|type=EST|length=397bp
CTTAATTACTTTCGAATTTTGATTCCCGTAAGCAGAGATCTTACTGATTT
GAAGAACATGGAAACTACTTGCGCAGGAAAAAAGTGGTCAGAGGGTTTTA
ACCTTCCGGTACCGAAGGTATTGCTAATGATGATATCATGAACGACAATC
TTGATCTTCTTATTGTTCCTCAATATGGAAGAAATCCCGATCATATGGGT
TAAGTGCAATACTGGTCTTTTATGTTTTATTTAATTAAATAAATGATAGG
TGTACTATTACCTATCAGTTATGTCAATGTCTCAGTCCAGTTTAATGTAA
CTTAAAAGATTTCTTGAGATGTACAAGAGATCTTCTTTGTTTGCTTTTGA
GTTAAGTATTTTCCTGAAAAGGAAAATAAATAAATAAAAGTTATTGT
back to top