BQ623094

Overview
NameBQ623094
Unique NameBQ623094
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length622
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00185 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00185 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623094 ID=BQ623094|Name=BQ623094|organism=Citrus sinensis|type=EST|length=622bp
TGGTAAATCTATGAAATATTTTTGCGTATAAAGGAGTATAGTTTTTGAAA
ATGAGACTCTTCTTATAAAAAACTGCTTGAGAAATTTATAATCTTACATG
GGCTCTTTGTTTCCTTTATTTTCTTTTTGAACTTGTGAAGTTTGTGGGAG
TGAGAGCTTAAGTGTAAAAATTATTCCCATTATTCTTGGAGACAATCTCC
TCCCCCCACAACGACAACAACAACCCCCCCCCCCCACCCGGGGGCAGGCG
ACTTGATGGTTTGGTCTATGAGCTTAAAGTTGTTCATTTTCTTCAACTTT
TTCTTTTAAGTAAATTTATGTACATCATTCAGCTTTTACCTTCAAAGGGG
ATTTAAGATTGTTTAGGAATTAGATAGTTCTGTTGTAGGTTGTTGCCCTC
GGAAGATGAATGTTGGAAGGTAAGTAAAGCAAAGCGTTTCCTTATCATTA
AAGTTAGTGATGGTTTCTGGATATTGTTTGACAGTGCCCTGAGCTTCAAA
ATCCATCCTTTTGCATACTCTAGTCCATTTTCTGAAATTTTATGATGCCC
AAAGGGTTTGGATCAAGTACTAAAAGAGTGGGGTGGGTCAAAAGTATCTT
GGGTATGCCAGGGTCATTGATT
back to top