BQ623099

Overview
NameBQ623099
Unique NameBQ623099
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length587
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9 contig Csv1_Contig9:1..587. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00190 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00190 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623099 ID=BQ623099|Name=BQ623099|organism=Citrus sinensis|type=EST|length=587bp
GTGAGCTTAGTGGGACACTGGAAAGTGAGTCAGAGGCAAAGTTGAAGAAG
CAGATTTCTGATGCTAAGAGCAAGGAGCATTAGCGGACATGATATCTTTG
CACCCCCTCCAGAAATTTTACCACGGCCAGCAGTGCGTGCCTTGGCATTG
AAGGAAAACTTCAACTTGGGAGACTCTGCTCCACAAGATGTACAAACATC
TGTCGGAGTCCTTACTCCTGCTGGAGACCAGAGCAGCATAAGTTCAACTG
AGGAACCTGTGATGAAGACATCAAAGAAAATTTACGATAAGAAATTTTCT
GAGCTATCAGGAAATGACATATTCAAGGGTGATGTTCCTCCATCATCTGC
CGAGAAGCCACTTAGTGTAGCAAAACTACGGGAGATGAGTGGCAGTAACA
TTTTTGCTGATGGTAAGGTAGAGTCTCGAGACTATCTGGGCGGAGTACGC
AAGCCTCCAGGCGGCGAGAGCAGCATTGCCTTGGTTTAACTTGTTAGGTC
TAACTGAGTTATTTTATCTACCCTGGCTGGTGTTGGGTTATTCATCGTAG
TAAGGGTGGGTGATTATATTATTTGACCGTCCATTGT
back to top