BQ623100

Overview
NameBQ623100
Unique NameBQ623100
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length465
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3659 contig Csv1_Contig3659:336..800. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of BQ623100 vs. ExPASy Swiss-Prot
Match: UBIQ_WHEAT (Ubiquitin OS=Triticum aestivum PE=3 SV=1)

HSP 1 Score: 131.724 bits (330), Expect = 1.495e-30
Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = 1
Query:    1 KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 198
            KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG
Sbjct:   11 KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 76          
BLAST of BQ623100 vs. ExPASy Swiss-Prot
Match: UBIQ_SOYBN (Ubiquitin OS=Glycine max GN=SUBI-1 PE=3 SV=1)

HSP 1 Score: 131.724 bits (330), Expect = 1.495e-30
Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = 1
Query:    1 KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 198
            KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG
Sbjct:   11 KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 76          
BLAST of BQ623100 vs. ExPASy Swiss-Prot
Match: UBIQ_SOLTU (Ubiquitin OS=Solanum tuberosum GN=UBI3 PE=3 SV=1)

HSP 1 Score: 131.724 bits (330), Expect = 1.495e-30
Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = 1
Query:    1 KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 198
            KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG
Sbjct:   11 KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 76          
BLAST of BQ623100 vs. ExPASy Swiss-Prot
Match: UBIQ_SOLLC (Ubiquitin OS=Solanum lycopersicum GN=UBI3 PE=3 SV=1)

HSP 1 Score: 131.724 bits (330), Expect = 1.495e-30
Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = 1
Query:    1 KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 198
            KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG
Sbjct:   11 KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 76          
BLAST of BQ623100 vs. ExPASy Swiss-Prot
Match: UBIQ_PETCR (Ubiquitin OS=Petroselinum crispum GN=PCUBI4-1 PE=3 SV=1)

HSP 1 Score: 131.724 bits (330), Expect = 1.495e-30
Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = 1
Query:    1 KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 198
            KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG
Sbjct:   11 KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 76          
BLAST of BQ623100 vs. ExPASy Swiss-Prot
Match: UBIQ_PEA (Ubiquitin OS=Pisum sativum GN=PU1 PE=3 SV=1)

HSP 1 Score: 131.724 bits (330), Expect = 1.495e-30
Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = 1
Query:    1 KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 198
            KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG
Sbjct:   11 KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 76          
BLAST of BQ623100 vs. ExPASy Swiss-Prot
Match: UBIQ_ORYSJ (Ubiquitin OS=Oryza sativa subsp. japonica GN=UBQ1 PE=3 SV=1)

HSP 1 Score: 131.724 bits (330), Expect = 1.495e-30
Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = 1
Query:    1 KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 198
            KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG
Sbjct:   11 KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 76          
BLAST of BQ623100 vs. ExPASy Swiss-Prot
Match: UBIQ_NICSY (Ubiquitin OS=Nicotiana sylvestris GN=UBICEP52-7 PE=3 SV=1)

HSP 1 Score: 131.724 bits (330), Expect = 1.495e-30
Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = 1
Query:    1 KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 198
            KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG
Sbjct:   11 KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 76          
BLAST of BQ623100 vs. ExPASy Swiss-Prot
Match: UBIQ_MAIZE (Ubiquitin OS=Zea mays GN=UBF9 PE=3 SV=1)

HSP 1 Score: 131.724 bits (330), Expect = 1.495e-30
Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = 1
Query:    1 KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 198
            KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG
Sbjct:   11 KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 76          
BLAST of BQ623100 vs. ExPASy Swiss-Prot
Match: UBIQ_LUPPO (Ubiquitin OS=Lupinus polyphyllus PE=3 SV=1)

HSP 1 Score: 131.724 bits (330), Expect = 1.495e-30
Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = 1
Query:    1 KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 198
            KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG
Sbjct:   11 KTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGG 76          
The following BLAST results are available for this feature:
BLAST of BQ623100 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 92
Match NameE-valueIdentityDescription
UBIQ_WHEAT1.495e-30100.00Ubiquitin OS=Triticum aestivum PE=3 SV=1[more]
UBIQ_SOYBN1.495e-30100.00Ubiquitin OS=Glycine max GN=SUBI-1 PE=3 SV=1[more]
UBIQ_SOLTU1.495e-30100.00Ubiquitin OS=Solanum tuberosum GN=UBI3 PE=3 SV=1[more]
UBIQ_SOLLC1.495e-30100.00Ubiquitin OS=Solanum lycopersicum GN=UBI3 PE=3 SV=... [more]
UBIQ_PETCR1.495e-30100.00Ubiquitin OS=Petroselinum crispum GN=PCUBI4-1 PE=3... [more]
UBIQ_PEA1.495e-30100.00Ubiquitin OS=Pisum sativum GN=PU1 PE=3 SV=1[more]
UBIQ_ORYSJ1.495e-30100.00Ubiquitin OS=Oryza sativa subsp. japonica GN=UBQ1 ... [more]
UBIQ_NICSY1.495e-30100.00Ubiquitin OS=Nicotiana sylvestris GN=UBICEP52-7 PE... [more]
UBIQ_MAIZE1.495e-30100.00Ubiquitin OS=Zea mays GN=UBF9 PE=3 SV=1[more]
UBIQ_LUPPO1.495e-30100.00Ubiquitin OS=Lupinus polyphyllus PE=3 SV=1[more]

Pages

back to top
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00191 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00191 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623100 ID=BQ623100|Name=BQ623100|organism=Citrus sinensis|type=EST|length=465bp
AAGACGATCACCCTGGAGGTGGAGAGCTCCGACACGATCGACAACGTGAA
GGCCAAGATCCAGGACAAAGAGGGGATTCCTCCGGACCAGCAGAGGCTCA
TCTTCGCCGGCAAGCAGCTCGAGGATGGCCGGACTCTCGCCGATTACAAC
ATTCAAAAGGAGTCCACTCTCCACCTTGTCCTCCGTCTCCGTGGTGGTGA
CTTCTAAAAAAATAAATGTGGATGTGTCCGCGTTTGATTGGATGGCGCTA
ATAATAATTAATTAGGTTGGATTGGGCGCTTTGCTTTAATTATTTTGTAA
TTACAATTGTGTAATGGCCAGCCGCTTGGGCCTAATTTCCTCTTTCTATT
GGTAATAATAATATAAGCACTAGTTTTTAAAAAAAAAAAAAAAAAAAAAA
AACTCTCGAAGCGCCTGCTGTCCTTGTTGTCCCCATCCATTCTGACCTTC
AAGCTTATTCAGCAT
back to top