BQ623102

Overview
NameBQ623102
Unique NameBQ623102
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length688
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig8672 contig Csv1_Contig8672:846..1533. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00193 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00193 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623102 ID=BQ623102|Name=BQ623102|organism=Citrus sinensis|type=EST|length=688bp
GCAATCGCTTCTGATGAAAAAATTGCCTTACTGGGTGCTATCCAGTCCTT
GTTTGAAGGGTCGATGTATACCTTTGTGTTCCTCTGGACTCCTGCTTTAA
GCCCAAATGATGAGGAAATTCCCCATGGTTTTATTTTTGCAACTTTCATG
TTGGCTTCAATGTTGGGAAGTTCCCTTGCATCTCGTTTGATGGCACGCTC
ACCACCAAGGGTTGAGAGCTACATGCAGATAGTTTTTGTAGTGTCATCTG
TCTCGCTATTGCTTCCAATTGTAACCAGTTTCCTGGTAGCACCTTCCAAT
GTGAAAAGTGGAGGCATCTCATTTTCAGGCTCTCTCCAGCTTCTTGGCTT
CTGTACCTTTGAGGCTTGTGTAGGCATATTCTGGCCATCCATTATGAAGA
TGAGGTCCCAGTACATTCCAGAGGAGGCCAGAAGCACCATCATGAACTTC
TTCCGCATTCCTCTCAATATCTTTGTGTGCGTTGTGCTGTACAATGTCGA
TGCATTCCCCATTACTGTTATGTTCGGCATGTGCTCGATTTTCCTCTTGG
GGGCATCAGTCTTGCAGAAGCGGCTGATGGTGATTGCAGACAAACCCAGT
GAGTTTAATCCTTGCACTATCCTTTTTGCCATTTAATAGCTTCTATTTTG
CATCTAAACTTCTTAAACTTGCATTACATCCCAGTTTA
back to top