BQ623107

Overview
NameBQ623107
Unique NameBQ623107
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length669
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5432 contig Csv1_Contig5432:9..677. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00198 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00198 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623107 ID=BQ623107|Name=BQ623107|organism=Citrus sinensis|type=EST|length=669bp
CTCTCGTCGTGTGTAGAACTTTCGGGTATCACATTACTGAAGTTATATTT
GCTGACGACTATGGGAGGTGACAAAGGGCTGTTTGGCTTTGGCGGTCCTG
GATATGGATCGTGTCCTCAAGGACAGAGCTATCCTCCATCGGGAGCAGCT
TATCCGCCACAGAGCTACCCGCCAAGTGGCTACTCAGCTGGGTACCCGCC
AAGTGGCTACTCAGCAGGGTACCCGCCAAGTGGCTACTCATCAGCAGGGT
ACGCGGCTTATCCTCAACAAGGCGGGTACCCCGTCACCAGTTACCCTGCC
GGCCCATCCCCTCCAAGTACTGGCTATTCTCATCATGGTGGATTCGGGGG
TTCCTATGGCACCCACCATGCGGCTCCCCACGGGCACTACGGTAGCCATG
GAAAGAACAAGGGTGGCTTCGGCCATGGCCACAGCCACGGCTACGGAGGA
GGAAAGTTGAAGAAGTGGAAGTGAAGATCCGATTACCTGTACCTTGAATA
ATATTCATACATCTTTATGATGTTTGGGTTTAAGTTACTTTTAAACTATA
AGTGCTTTCTGGCTTCTTGTATCTAATAAGAAATGTGCTCTCAATAAATA
AATGAAACACCCTGGGGTCTGTGGAGGAATGCATACTTGTCTTCCATAGT
ATTTTCCAAATTAATATAA
back to top