BQ623190

Overview
NameBQ623190
Unique NameBQ623190
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length606
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00281 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00281 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623190 ID=BQ623190|Name=BQ623190|organism=Citrus sinensis|type=EST|length=606bp
CTCAATTCTACATGCATTTAAATTCTTATTGCTGTGTTTGCAAATCTATC
TTTCTTAATGGGTGGTTACATCCCTTTGTGTGGTGAACATATTTGTGAGG
ATTGATGCCTTGATTTTGTGCATTTATGCATTATGAGATCACAGTTTGGT
AAAAGTTCTGATGAGAATTGATACCATTCTACGTTTCTGCTTGAGTGCAG
TACCTTTTTGGAGTTTGTTTTGGTATTGCCATGTTATAGCTTGTTATAGA
TTGCTTTGCTGGTGCTTTAGTTTGTTAATGCATGTATGATTGAGGTGCCA
AAGTTTATTAAAATACGTTTGCTACTCTCATGTCTTTTTCCTTCAAGCAT
CCATGAGAAAAACTTGAGGGCATTGTAAGCGATTACTTAGCAGTGGATAA
AATCATAGAACTTGTAGTGATGTCAATATATTGGAGAGGAATGTCATACA
TGATTTTGGTGTGCTGATTGACTATGATATGGTGATAATTTCTACATCAA
AAAGTCAAATGGTATCTTTATTTCCCCAGATATCTTTAGTTAGCTATTTA
TTGGTTCTGATTTTTCGCTCTAGAATGAATAATAAGGTTGGGGCATTCTT
TATTCC
back to top