BQ623238

Overview
NameBQ623238
Unique NameBQ623238
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length305
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00329 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00329 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623238 ID=BQ623238|Name=BQ623238|organism=Citrus sinensis|type=EST|length=305bp
GTTGGACTATTCCACATTGGCACAGTATTGTGGAGGATGACACCGCAAAC
GATAATCTTGATCTTCTTGTTGTCCCTCAATATGGGAGAAATCTTGACCA
CACTGGTTAAATCTAAGAGTGTTACTCTTTTATACTATGTTTAATTAAAT
AAAAGGATGGGTATAGTTATTACCTGTCAATTATATGAGTTTCAATTTAG
TTTGGTTGTACTACTAAAATCTCTTGAGATATACAAGAGATTTTCTATGT
TTGTGTCCGTGTAATTTACTTTCCGTAATAAATAAAACTATTGTGCATCA
ATGTG
back to top