BQ623240

Overview
NameBQ623240
Unique NameBQ623240
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length644
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
BQ623240_ssr63 microsatellite BQ623240_ssr63:63..72. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig8054 contig Csv1_Contig8054:128..770. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00331 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00331 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623240 ID=BQ623240|Name=BQ623240|organism=Citrus sinensis|type=EST|length=644bp
ACAGCTGGAGAGAGGTGAATCTGCCGGCTCTGTCGCCCACGGCGGCAGCA
GAACCAGAGCTTGAGAGAGAGACAGGGGAGAGAAGGAGAGGCAGAGACAT
ATTGATAGCCGTCGATCATGGTCCCAACAGCAAGCACGCCTTCGATTGGG
CCCTCATCCATCTCTGCAGACTCGCTGACACCATCCATCTTGTCCATGCT
GTTTCCAGTGTGCAGAATCAAATTGTTTATGATATGAGCCAGGGGCTGAT
GGAGAAGCTTGCTATAGAGGCTATGGATGTTGCTATGGTGAGGACTAAGG
CTCGGATTGTGGAAGGGGATGCAGCTAAGGTAATTTGCAAGGAAGCTGAA
AGGTTAAAACCAGCAGCTGTGGTGATTGGTAGCCGAGGCAGAGGCCTAAT
ACAGAGTGTACTGCAGGGGAAGTGTGGGTGAATATTGTTTACACCATTGT
AAAACTGCTCCTATTATAGTTGTTCCTGGAAAAGAAGCCGGAGATGCATC
ATTGATATGATGGAACCAGCTACACTTTTGGGGATCTGTAGGTCATGAAC
TTTGTGTGCATTGTGTGATCGTTCAATTGATTGTTTTTATTAGCTAGTGT
TAGGAAGAAAGCTGCATGGAAGAATGTCTGTAATATCTAAAGAA
back to top