BQ623241

Overview
NameBQ623241
Unique NameBQ623241
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length279
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10954 contig Csv1_Contig10954:535..813. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00332 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00332 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623241 ID=BQ623241|Name=BQ623241|organism=Citrus sinensis|type=EST|length=279bp
GGAAGGACCAACAAGCCCGTCGTGATCGCTGATTGCGGTCAATTGTCTTA
GATTTGATCATGATAATGATCGCCATCATCACGAGCCGTCTGATCGCGAT
CGTGATGGTGATTATGTTATCTATTATTATGTGGCCGTGTCTGTAGGACT
TTTAATCTTTATCTAATTTTCCTGCTATGTTACTTGTTCGGGTTGGATCG
GGTCTCCGGTGGTGGTTCTTGATGAACTGTTTTTTATGTCTTTCTATGAG
CTGCCTTTTTAAATAAGATAGGGCTTGTC
back to top