BQ623247

Overview
NameBQ623247
Unique NameBQ623247
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length352
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1550 contig Csv1_Contig1550:1472..1823. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00338 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00338 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623247 ID=BQ623247|Name=BQ623247|organism=Citrus sinensis|type=EST|length=352bp
TTTGAAGGAAATTGAATCGCTTCCAAGTCGTGTATCCACAAAAACTGCCC
ATGTCATACCCATGGTCAACGAAACTCAGGGTGATAAGCCACTTAAGAAG
AGTGTGAGGGAGACTCAGGAGGAAGTCACCAGGCACTGGAAGAGGTTCGT
GAAAGGCCGGAGAGCTGGAGCATGCTGAGGTTCCAAACATAAGATGAGAC
AAGATTTGTATGCTTGTTTGAATATTAAAGCTATTGCTTCTTCCTGTTTT
CTGTATATTCGTACTTGAAGGTGTGTTTACTTTATGTGATTGTTGAAGCC
TATTTATGTTTTCTTGCACGCTTGTGAAGTGGCAAATAGAGGTATATGCT
TA
back to top