BQ623250

Overview
NameBQ623250
Unique NameBQ623250
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length457
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00341 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00341 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623250 ID=BQ623250|Name=BQ623250|organism=Citrus sinensis|type=EST|length=457bp
TCCGAAGGATGTTTGGGTTTCAAGACAGGCAGGGATGAAACGGAAAATGG
ATAGCCAAACTCCGGAGATCTCACAGAGGAAAAAAGCCAAAGTGAACGAA
AGATGAGATGTATGTGATTCCAAAATAGGTTTCTGTTCCAAGCTGAGAGG
ATTTTTAACTATGTTAAGGATGATACATGCATGAATCAAGCATTTGCAAT
GAGATTATGGTATCTTTGTGATTACCTTGCGATGGTAAAGATGACACGTG
CTTGGATCAAGCATTTGTAATGATAATACTTTGTGGTCATCTTCGGCCTT
TTATGCTATTGTGTATTGGTACGTTCAATTTCATTAAATTGAATTAATAT
TATTAATTAATGTCATTGTGATATGCTTCATAAACTTCTTACCTTTTATT
CGTTGGATATAAATCTAGTTGTTTAATTATATTGCTCGAAAAAAAAAAAA
AAAAAAA
back to top