BQ623258

Overview
NameBQ623258
Unique NameBQ623258
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length683
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig15 contig Csv1_Contig15:1..684. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00349 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00349 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623258 ID=BQ623258|Name=BQ623258|organism=Citrus sinensis|type=EST|length=683bp
AGAAGCGTCGGGCAAAGACATTTTTTGAGTTTCAAAGAAACGCCTAGTGG
AAGCAACCGTACTTTCGAATGCTCTCCTTCCGGTCCCTGCGTTCGCTGTC
TTTACTCCGAAAAGATTGACGAAAAGTATCGATGCAGTGAGACTGGTTAT
CGTATTCCATTGAAATGTGTAGAAAGTGAAGATGTTTCCAATGTTGAGAA
TGAGAAAAAGACTCGTGGTGCTCTTGAGATCTCCACTGACAGTGAGAAAC
CACATGTGATATTGCATGATGCAGTAGAGCTCACAACATCAATAAAACAT
AGAAGCTTACTGGAAGATTCATCTACATCTAAGGGTAAGTCTCAGGCTTA
CATTACTTATAGAAGCTGTATACCGGCGGTTAACGAAGAGAAGCTGTCAG
TACTTGGTTTCGAGGGGATTGTATTCTGTTTGCTGCTCATTAGCGGTTCA
GCTGTATACTTGAGAAGAAAGCGGACCGTAACAATGTCAGGAATAGGAAC
AGGGGAGAATCCAGGCTAACTCCAGATTCTAATTTGGAAACCTCTAATAT
TTCATGCTAGCTCTTCCACTGAAACCAATTTCTTGTGATCATTTAGTGCT
AAATGGGATAAAGAATTGCAGGCCAACTATTTAACACGTACCTTATGCAC
CTATCGTCTCCTTGACGGGATTCTTGGCTTTGT
back to top