BQ623260

Overview
NameBQ623260
Unique NameBQ623260
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length455
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
BQ623260_ssr422 microsatellite BQ623260_ssr422:422..441. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig3767 contig Csv1_Contig3767:462..916. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00351 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00351 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623260 ID=BQ623260|Name=BQ623260|organism=Citrus sinensis|type=EST|length=455bp
AAACATAGACATTTTCAGTTGGTCTCTGTCAGACGATGAGTGGAACCGCT
TGAACCAGATTGAACCGCAGGTATGTTTATTTGGAAACGAGCCTTTGAAT
AAGCTGTCAGCCTCAGACAGTGGCTTCACATTTGGTAGCGGTCCCCTTCA
ATCTGTGCGGGAGATGGAAGATGATGTGGAGTCCAATGCCTGATTTTTTT
CTTGAGATAATGTGTCTTCTTTTTTTTTTTCTCCCCCAAAGATGTCATCA
AATTACAGTTTGTCAAATACCCATTGTTGTAAGATTTGGTTCTGTGGATG
CTGAATAGAATGGTCAAAGATGGGTTATTGATTGAATTGGCATATGTTTG
TTCCTAGCTTGCTAGTCCTATCTTCAACAAATTACCGCTTGTTCCTTGAA
TCACCTGTGCAACTTCCATGGATATATATATATATATATATACATGTACA
CTGTT
back to top