BQ623338

Overview
NameBQ623338
Unique NameBQ623338
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length631
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9992 contig Csv1_Contig9992:606..1237. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_00429 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00429 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623338 ID=BQ623338|Name=BQ623338|organism=Citrus sinensis|type=EST|length=631bp
ACTAACGGCAGTAACAGTTGGGCCTCCAATAATCACACTTCAGCATTGAA
CACCAGCAGTTTGAATAGTGGGGGCCTTAATAACCTGAACTCTATTGGGT
TCATGAAACAGACTCAGAGTATCAATAGCGACAAGAAATCAAATGATCTT
GGATCAATATTTAGTTCTAGCAAAACAGAACAGACAGCACCTAAACTTGC
TCCTCCTCCTTCAAACGTTGTTGGTAGAGGAAGAGGAAGAGGGAGAGGGG
TCATTACAACCTCACGACCTAGTCATGTCAAACCATCTTCGGAGCAACCT
CCCCTCTTGGATTTGCTGTAACTGAAGTGATTTTTGCACTGTTGCATTGC
AAACATATTACACTGGAATTTTTGGAAGTCACCTTGTAGAGTAGCCACCC
CACGCTGTACAGAGATGGCCAGATCCTGTTTAGTGTTTAACGTACAAGTT
CATCTATCATCTTGGACATGCAACCTGTTTAATATGTTTAACGTACAAGT
TCATCTATAATCTTGGACATGCAACTGCAATGGCTCTCGGGATTGCATGG
GTTGGTATATAGTCATTTTGTTGCAAGTTGGTTGTAATTTATCGTGATTC
GTGCTGATCTCGTTTTGGTTTTGGGTTGGTA
back to top