BQ623349

Overview
NameBQ623349
Unique NameBQ623349
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length330
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5019 contig Csv1_Contig5019:394..723. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUSDA-FP_00440 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00440 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623349 ID=BQ623349|Name=BQ623349|organism=Citrus sinensis|type=EST|length=330bp
GCATTATTAATGATGAGAGCGTGAATGACAATCTGGATCTTATTGTCGTC
CCTCAATACGGAAGAAATCTCGATCACACTGGTTAAGTGCTATCTTACTC
TTTCGTATTATGTTCAATTAAATAAAATGATGGGTTATTAATACCTGTCA
ATTATGTGAGTGTCTCTGTTTGTTTTAGTTCAACGTATAAAATCTCTTGA
GATATACAAGAGATTTTCTTTATTTACTTTTGTGTACGGTGTCTTCTTGA
AAAAAGAAATTAATAAAAAATATCATTGTGTGAAAAAAAAAATTCCCCCC
CCAGCTCCCCCTCGCCCATGAAAAAACTCT
back to top