BQ623350

Overview
NameBQ623350
Unique NameBQ623350
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length330
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00441 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00441 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623350 ID=BQ623350|Name=BQ623350|organism=Citrus sinensis|type=EST|length=330bp
AGACTCCGAAATCTGGGGGACAAGTCACATGTTCATCCTGCAGCAAGACA
TTTAACTCCGATAATGCTCTACAGTCTCATACAAAGGCTAAGCATTCTGC
AAAATAGAGGGGTTCATGTTATAACATGCTCTGCTGCCGGTCGCTGTGGC
ATGTTTATTTTTGCGAGCACATATGGAGAGCTATGTGTTAATGTTTATGT
TAGGCTTTTGACAGAAAGTGAATGAGCTAGTACTGCAGCGCTTTCTACTA
TTGTTATGGATGTCTTGTTTTTAGTGAATTTATATTTAAACTTGCTTTCT
CTTGATTTCTAATGTCAAATGTGTGATGAT
back to top