BQ623359

Overview
NameBQ623359
Unique NameBQ623359
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length498
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1120 contig Csv1_Contig1120:169..666. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionUSDA-FP_00450 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00450 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623359 ID=BQ623359|Name=BQ623359|organism=Citrus sinensis|type=EST|length=498bp
AAAAATGTCTGGCTGTGGTGGAAACTGTGGCTGTGGTTCTAGCTGCAAGT
GCGGCGGCGGCTGCGGCGGTAGCGCCATGTACCCTGACTTGAGATCCTTT
GAGAGCACCACCGTCGCCACCGAGACCCTCGTCCTCGGTGTTGCTCCTGT
CAAGATGCACTCTGAGGGGTCCGAGATGGGATTCGGAGCCGAGGGCGGCT
GCAAGTGTGGACCAAACTGCAAGTGCAACCCTTGTAACTGTTAATGAAGA
TTACGAGACGTGAACATGCCCCATAATAAAGCAGCGCTGTGAGGTCGTTT
AAATTGTAGTATCAATAAAAAGAACTATTTGTCTTTTGTGGTTGGCTTTG
TTGGATGTCTTTTTATGAGCTTTTGTTTGTAAAATAAAAACCAGCCATGG
CTGCTTCTCCGAATCCTTAACTGGGTTTGTTGCAGATCCATGGCTAGTTA
ATTAATCATTAAGTGTATCTGTTACTGCTGCTTTTCTAATGGGAAGCT
back to top