BQ623593

Overview
NameBQ623593
Unique NameBQ623593
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length527
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUSDA-FP_00684 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00684 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623593 ID=BQ623593|Name=BQ623593|organism=Citrus sinensis|type=EST|length=527bp
TGTAAGATCCCTGGTTATGAAAACACAAGAAAGACGGCGTTTTGTCCCCT
TTCTAGAAGCTCTAAAGTCGCAAGATGTGCCTGTGGACACACCATCTGGA
GGTAATATGCCAACATTTTCTCGAATAAAGGTTTGGGACCCTTATAAACG
TCTTGGAATTAGTCCATATGCTTCAGAGGAAGAGATTTGGGGATCACGCA
ATTTTCTCTTGGAACAATATACTGGACATGAGAGAAGTGAAGAATCAATA
GAAGCTGCTTTTGAGAAATTACTAATGACCAGCTTCAGACGAAGGAAGAA
AGAAAAAATTAATTTGAAAAGTAGGCTAAAGAAGCAAGTAGAAGAGTCTC
CACCGTGGTTCAAAAACTTGCTCAATTTTGTGGAGCTTCCTCCAAAGGAT
GTTATTTTTAGAAGATTGTTTCTGTTTGCATTCATGGGTGGCTGGAGTAT
CATGAATTCTGCTGAAGGGGGACCTGCTTTCCAGGTAGCTGGATCTTTGG
CTGCTTGCATATATTTTCTTAATGAGA
back to top