BQ623601

Overview
NameBQ623601
Unique NameBQ623601
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length468
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUSDA-FP_00692 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00692 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623601 ID=BQ623601|Name=BQ623601|organism=Citrus sinensis|type=EST|length=468bp
TCATGAAATTGTTGGTTTCATTGAAGAAGAGAAGGATAAGTTTCCTACAG
TTAAGAGTTCAATATTTTTCAATTCTCCGCCTCAGTTGGTCGTGCTTGCT
CAGGAGGGGCAACACAAGGAAACCATAAGCATTGACAATTGGAAACGGGA
ACATATGCTGCAGTTTCTAGAAGAGAAGGTTAAGCCTACTTCAGCAAAGA
TTTAGAGTGATTTATAACTGGCTTGCTTTATAGAAAAACTGAATTATGTG
CAACAACTATGCTATGAAATCAGGCATAACTCATTACCTTTTTGTTCTTA
GTTTGAGTAACAAATCCAAGTGTAATGAATTACTATCTGGCACACATTTA
AAGTGTTTTTGGACATCTTCTGGAGAATCTATTTGCTTCAAGATGAACTC
TGCTACTCTGATATTATCTGACTTTAGTGACAAGTTTTGAGAACTTTGTA
GATATGCTTGGTGGACAA
back to top