BQ623604

Overview
NameBQ623604
Unique NameBQ623604
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length341
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10323 contig Csv1_Contig10323:501..841. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_00695 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00695 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623604 ID=BQ623604|Name=BQ623604|organism=Citrus sinensis|type=EST|length=341bp
GCCCAGTTCTACAAGGACTTGTTGAGTTAGAAGCTGCTGTCTGCTTGTGC
ACTACTCTCAAGCTCAAGCTGCTTAATCTTAACATCTATCTTCCACTTGC
TCTTCAGCTTCTTGTCACTTGCGGAAAGACACCACCCGCTGGTTTCACTT
GCACTCTTTAGATCTAAGGTTGGTAGATTGATGATGGATACTGAAGGAAG
AAATCGACATGAAAGGATGTCGAGACTTATTTGTTTGTTTCTTTTTCTCT
CTCCCCCACTCTCTCTGTGTTTCTCTCATTGTTGGGATTGTAATGTTTGG
TCACATTTAATTGTACACCCATTTGTTTTTATATGATTTGT
back to top