BQ623606

Overview
NameBQ623606
Unique NameBQ623606
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length718
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11347 contig Csv1_Contig11347:633..1350. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_00697 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00697 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623606 ID=BQ623606|Name=BQ623606|organism=Citrus sinensis|type=EST|length=718bp
CCTTGTTGCAATAAATTCTGGAATCCAGGCATTTTTGCATCCAAATATTA
GTCTATCTCAAACTTCCCTCATTGAGGTCTTTGTATACAAGAGGTGCAGA
AATATAGCATGTCAAACCCAGCTTCCAGCTGATGATTGTACCTGTGAAAT
ATGCACCCACAGGAATGGTTTCTGCAATCTTTGCATGTGTGTAATCTGTA
ACAAGTTTGATTTTGAAGTGAACACCTGCCGTTGGATTGGATGCGATTTG
TGTTCTCATTGGACTCACACAGACTGTGCAATTCGTGATGGACAAATTTG
CATGGGCCCTTCTGCCAAAAGTGGAGCATGTCCCTCTGAGATGCTTTTCA
GGTGCCGGGCTTGCAACCGGACGTCTGAGCTGCTGGGCTGGGTGAAAGAT
GTATTTCAACATTGTGCTCCAGCCTGGGACCGCGAAGCTCTTATGAGGGA
ACTTGATTTTGTTAGTAGGATCTTTCGTGGAAGTGAAGATCCTAGGGGGA
GGAAACTCTATTGGAAGTGTGAGGAGCTTCTAGAAAAAATGAAGGGTGGG
CTTCCAGAGTCAATGGCCTGCAGAGGAATATTGCTGTTTTTCCAAGAGCT
TGAGGGTGACTCTCCAAAGAGCCTGGAAAACGGAGAAGCTGGTAGGCTGA
TTGCTCCACACGAGGCATGCAACCGAATTGCAGAGGTTGTACAGGAGGCT
ATAAGAAAGATGGAAATG
back to top