CA588034

Overview
NameCA588034
Unique NameCA588034
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length278
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Libraries
Library NameType
Washington navel orange leaf axil budcdna_library
Properties
Property NameValue
Genbank descriptionGS1487 Washington navel orange leaf axil bud Citrus sinensis cDNA clone DD21.2 5 similar to hypothetical protein [Oryza sativa (japonica cultivar] (BAC16647), mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CA588034 ID=CA588034|Name=CA588034|organism=Citrus sinensis|type=EST|length=278bp
TGGCTGAAAACCGAGCAGGTTAAATATCCTGATTTGAGTGAGGCCTTTGA
AGTGTGGTGTTACAGAACCAAGTCAGCAAAGAGAAGATTGTTAGAAGGAA
GCTTGGATAGGGTTGGCAATACCACCCTTAGCCTTTGAGCTATTGTGCTA
ATGTTGTTGTAAGATTTTTTTTTTCCTTTGGTGTAAAGATTCTTATAATC
CCATTCAATGTAGCGGCAACATATTATGTTCTATTTGATTATTTTGTTTC
AATTTCAATCATGCATGAATGATTCTTC
back to top