CA588041

Overview
NameCA588041
Unique NameCA588041
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length476
Libraries
Library NameType
Washington navel orange leaf axil budcdna_library
Properties
Property NameValue
Genbank descriptionGS1411 Washington navel orange leaf axil bud Citrus sinensis cDNA clone DD4.2A 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CA588041 ID=CA588041|Name=CA588041|organism=Citrus sinensis|type=EST|length=476bp
TTGCATTCAATACTTGCAATTGTGCAGCAAACGAATTGATCTAGCTCAAC
TCCTAATTTTTTCTCACTCTGGGCTCTAAACCAAGTTTTTTTGGCGGGAT
TTTTGCAGGAGTATGGCACTTCGATCAAATGCTTCTCCACGAGGGTGATG
CTGCATGATGAAGAACCATATTGTTACATTTCTTTGTGTTTTAGTCAACT
CTTTGCTGCTAAATGTTCTGAGTATCTCTGCCACGGAGGTTGAATGTGTT
GCAAAAAATAAGCTGAAAGACTGATAAGTCCTACAAAGTCAATACTCAAT
AGCCTCCTTGCTTTATCATATTAGTGTGGTCGCTTTGATAGTCTTTTTTA
TGGTGCTTTTTCTTTATTTAGTAACAGACAGTGTGAAGGGATCTAATAGT
TTAAGCAGAGCACCAAATCCCATCTTCTGATTGTATAAATATAATTATTG
TTGTTCTTATTTTGTTCTGTTTCTGC
back to top