CA588042

Overview
NameCA588042
Unique NameCA588042
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length473
Libraries
Library NameType
Washington navel orange leaf axil budcdna_library
Properties
Property NameValue
Genbank descriptionGS1412 Washington navel orange leaf axil bud Citrus sinensis cDNA clone DD4.2B 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CA588042 ID=CA588042|Name=CA588042|organism=Citrus sinensis|type=EST|length=473bp
GCTTATTACTTTGATCTGATGCATGCCCAAACTAGGAACAATGACCAAAT
GCTCACCCGAGCTTTCTGTGATCTCTAGTGAAGAAGATTCTGACACTTTA
GTTGGATGCTTTGTCCTCGATTCTTTTATCAAGACAGTGCTGATACATCT
GACGAGGACTGATGTGTCAACGAGTTCATGCATGGTAAGGCAGCAATATC
AAAGCTGAAGTCATTGGCAAGGTTGGTTGGAGTCGAGGATCCGCAATCCG
GACCTGGGATTGTGCTGACTAAAGCCGTGGGTGTCTTGAGGGATTTGAAT
AGTAGGGAGCACCGTCTTCCTAACTGTTCTTGTTTGGCTGTAGTTATTTT
TACTATATCCCTTACTGGAAATCTTCTACCTTCGGGAATGGAAGCAAGGG
TTTAGGTNAATTTTATGCATCTCAACCAGACTGCTTGGACATACGTACGA
CAATGGTATAAAAATATTATTCA
back to top