CA588043

Overview
NameCA588043
Unique NameCA588043
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length561
Libraries
Library NameType
Washington navel orange leaf axil budcdna_library
Properties
Property NameValue
Genbank descriptionGS1407 Washington navel orange leaf axil bud Citrus sinensis cDNA clone DD1.3 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CA588043 ID=CA588043|Name=CA588043|organism=Citrus sinensis|type=EST|length=561bp
TTCGGTACTTGCCTTTGTGCAGCAAACGTTTTGGTCTAGCTCAACTCCTA
AATCACATTCACTCTGGGCTCTAAACCAAGTTTTTTTGGCGGGATTTTTG
CAGGAGTATGGCACTTCGATCAAATGCTTCTCCACGAGGGTGATGCTGCA
TCATGGAAGAACCATATTGTTGCATTTTTTTGTGGGTTTAGTCACTCTTT
GCTGCTAAAAAAAAATGCTCTCCACGAGGGTGATGCTGCATGATGAAGAA
CCAGATTGTTACATTCTTGTGGTTTAGTCAACTCTTTGCTGCTAAATGTT
CTGAAGTATCTCTGCCACAGGAGGTTGAATGTGTTGTCAAAAAATAAGCT
GAAACAGTGATAAGTCCTACAAAGTCAATAGCTCAATAGCCTCCTTGCTT
TATCATATTAGTGTGGTCGCTTTTAGATAGTCTTTTTATGGTGCTTTTTC
TTTATTTAGTAACAGACAGTGTGAAGGGATCTAATAGTTTAAGCAGAGCA
CCAAATCCATCTTCTGATTGTATAAATATAATTAAGTTGTTCAATAAAAG
TTCTGTTTCTG
back to top