CA588046

Overview
NameCA588046
Unique NameCA588046
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length330
Libraries
Library NameType
Washington navel orange leaf axil budcdna_library
Properties
Property NameValue
Genbank descriptionGS1415 Washington navel orange leaf axil bud Citrus sinensis cDNA clone DD7.2 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CA588046 ID=CA588046|Name=CA588046|organism=Citrus sinensis|type=EST|length=330bp
AGGAAAGTGAATTGAGCCCCGGCCCCAATGGCTTCTCTTTGCTTGTTTAT
ATCCGGAAGAAATAATGAAAGCTAGCAGCTGGTGCTTCAATTATTCTTTG
GTAATGTTTTTATTAGAAATTAATTAAATTAATTTTAATTCTCACTAACC
CCCATTTGTTTATGAACATATGTAGTTTAGAATAAAAATTGAATCAAATC
ATTAGGACAAATACACATTGATAGTACTTAAATTATTCTCTTCTTCATCT
GACATTATTTCTAGTATGCGGTAGTTCAATGTAATCAAAGTACCAAAACA
GATCATAATCAAAAATTGAAAGCCATTGTT
back to top