CA588047

Overview
NameCA588047
Unique NameCA588047
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length283
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Libraries
Library NameType
Washington navel orange leaf axil budcdna_library
Properties
Property NameValue
Genbank descriptionGS1479 Washington navel orange leaf axil bud Citrus sinensis cDNA clone DD9.2 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CA588047 ID=CA588047|Name=CA588047|organism=Citrus sinensis|type=EST|length=283bp
TGGCTGAAAACCGAGCAGGTTAAATATCCTGATTTGAGTGAGGCCTTTGA
AGTGTGGTGTTACAGAACCAAGTCAGCAAAGAGAAGATTGTTAGAAGGAA
GCTTGGATAGGGTTTGGCAATACCACCCTTAGCCTTTGAGCTATTGTGCT
AATGTTGTTGTAAGATTTTTTTTTTTTCCTTTGGTGCAAAGATTCTTATA
ATCCCATTCAATGTAGCGGCAACATATTATGTTCTATTTGATTATTTTGT
TTCAATCATTCATGAATTATTAATGATTCTTCC
back to top