CA588048

Overview
NameCA588048
Unique NameCA588048
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length278
Libraries
Library NameType
Washington navel orange leaf axil budcdna_library
Properties
Property NameValue
Genbank descriptionGS1480 Washington navel orange leaf axil bud Citrus sinensis cDNA clone DD10.2 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CA588048 ID=CA588048|Name=CA588048|organism=Citrus sinensis|type=EST|length=278bp
CCAAGTTGACGTTGGCTTGAATCAGAAATTAGACCAGGACAAATTCATGC
CAGCTCAACTGGTGAAAGAATCTGCTCAAAATGGTAGGAAAATGGAAGTT
GCTCAGCAGTCGATGCTGGGCAGGAAAGGAAGTATTCAGAAAACTGCTCA
GTCGGCAAATGCAAGTGAGAGTTTGGAAAGAAGAGAGAAGAATGTGAGTG
CGACACTTACATCAAAAGATAAAGATGCTGAAAGGGTGAAAAGGCAAAGA
GAGCTAGAAATTGAACGTCTTAGGAGGA
back to top