CB250241

Overview
NameCB250241
Unique NameCB250241
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length349
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
CB250241_ssr162 microsatellite CB250241_ssr162:162..173.
Properties
Property NameValue
Genbank descriptionEST0002 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ002, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250241 ID=CB250241|Name=CB250241|organism=Citrus sinensis|type=EST|length=349bp
ACGGATTGCTTAGTCAAAAAGCAAAACAAGGAGTCAATCAAGATTAGAAT
TTCAGAAATATTTTTAGAAAATAAGTGTCACTGCAAATCCAAAAAGGGAA
AGAAATAAAATCTCTCAATATATGCGGGAAATAATATACAGTCAATGATT
ATCGCCCAAGAATATATATATATTTTTTTTAAGTTTCCTATTCTGATCTG
GGTAATAAAAACATAAAAGAGTAGCAAGAACAAATAAGATAATTTAGAGA
AAATAAATAAAGAAATTCGAATATAACAGAAACAAAACCAACTGGTTTAA
GTTACTAAATCTTGTAAAAATTTTTAAAAAAAAAGAAAAAAAAAAAAAA
back to top