CB250247

Overview
NameCB250247
Unique NameCB250247
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length523
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig108 contig Csv1_Contig108:1..523. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionEST0010 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ010 similar to glyceraldehyde-3-phosphate dehydrogenase (acc# AAM92008), mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250247 ID=CB250247|Name=CB250247|organism=Citrus sinensis|type=EST|length=523bp
TGGGGTTACAGTTCCCGTGTGATTGATTTGATCGTCCATATGGCAAAGAC
TCAAGCATAAAGCTGAATTTGTCGATGGTCCAAGGCCTTTGTTTTTCATG
TTTCAGTTGGGTCTTAAAATCTTAATCCTTATGATTTGGATGTTTGGAAT
AAAGGACGAGTGCTTAATGGTCTTGGTTTTGGTTTATTATATGTTTAGTT
ATGAGGTTTATGGTTTTTCCCTTTGGGGGGGATTTGGAAGGCACAGAGTT
GAACAATTTCATTAGTTTTTAACTTCCTTATATGAGAAACAGCCTTCTTT
CTCTGTTCTTCTCATATTAGTTCTTGAATTCTGATGCTTGTGAAATCCAG
TTCATTATAATACCAGTGGATAGATGTCCATTTGGAAGTATAGTAATAGA
TGGGGGTATTATTCATTTCTCCACCCCAGCAATAAATTTTTTTTCACGAG
TTGCAATGATAAATGAACAAGATCATGATAAAATCATGAATTCTTATTAC
AAAAAATGGTGTCTTCCACAATG
back to top