CB250260

Overview
NameCB250260
Unique NameCB250260
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length370
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionEST0027 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ035, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250260 ID=CB250260|Name=CB250260|organism=Citrus sinensis|type=EST|length=370bp
ACAATCCTGATTACCTTGAACGTCCTTTCATTGTGGTGCTCAACAAGATT
GACCTTCCTGAGGCAAGGGATAGGCTTCAATCCTTGACTGAAGAAATACT
GAAAATTGGATGCGATAAGGTAACTTCTGAAACAGAGTTGAGTTCGGAGG
ACGCAGTTAAATCATTGTCGACTGAAGGTGGCGAAGCAGATCTTCTATCT
TCTGTGACGTCTGTAAAAGATAAAAGGGATAAAGAAATTGAGGACTATCC
ACGCCCTCTGGCTGTTGTCGGTGTTAGTGTCTTGAAAGGCATCATGATTC
ATGAGATGCTGAAGGAGATTAGGGCAGCCTTAAGAAAATGTTGAGATTCC
AATTTAGTGCCGGGGCTAAG
back to top