CB250263

Overview
NameCB250263
Unique NameCB250263
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length256
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11837 contig Csv1_Contig11837:511..766. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionEST0031 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ040 similar to expressed Arabidopsis protein (acc# NP_566837), mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250263 ID=CB250263|Name=CB250263|organism=Citrus sinensis|type=EST|length=256bp
ACAGGTGTTGGGCTCACTGAGTGTGCTGGCGACACTATTGCAGACAAAAG
AATTGGATGAGTCAATGCTAGATGCACTTGGCATTCTTCCCCAGCGTAAA
CAACATAAAAAACTCTTGCTGCAAGCTTTGGTCGGTGAGGGCTCTGATGA
AGAACAACTTTTTTCTCGTGGAAGTAGTACAGATCCTCAACCAGACGCCT
AAAGAATTATTTACATTTCTCTCGACATAGCGTCCAAGACCAATAAGTCG
AATCAT
back to top