CB250292

Overview
NameCB250292
Unique NameCB250292
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length234
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionEST0070 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ094 similar to unknown Arabidopsis protein (acc# NP_191760), mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250292 ID=CB250292|Name=CB250292|organism=Citrus sinensis|type=EST|length=234bp
ACTTCTTTCCTGGTCAGCGAACTTCCAGCCACATACAAATTCACGGTGCA
CCACATGTTTACAAGGTGGATGGATACCCTGTGTATAGTACGGCAACTCC
AACAATTTCTGGTGCTAAAGAGATGCTGGCTTATTTAGGTGCCAAGACCA
AAACAGAAGGATCCTTTTCTCAGAAAGTTATATTAACTGATCTGAGAGAG
GAAGCTGTTGTTTACATTAACGGCACGCCATTTG
back to top