CB250293

Overview
NameCB250293
Unique NameCB250293
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length453
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionEST0071 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ095 similar to putative transport protein (acc# NP_178363), mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250293 ID=CB250293|Name=CB250293|organism=Citrus sinensis|type=EST|length=453bp
ACTTGAGCTTCGTGGGGCAATTCCTGTTGGTTATTGGATGCAACTCAAGC
CTGTGTTGCTGACTGTCTTATCTGTTCTTGGGAACATGGTTCCCGTGCCA
TTCATTATACTTTATCTCAAGAAGTTTGCTTCATTCCTTGCTGGGAAAAA
CCGGTCCGCATCTCAGTTCCTTGATATGCTATTTCAGAAGGCCAAAGAGA
AAGCTGGCCCAGTAGAGGAGTTTCAATGGCTTGGCCTTATGCTTTTTGTG
GCTGTGCCATTTCCTGGAACAGGAGCTTGGACAGGAGCCTTCATTGCTGC
CATTCTTGACATGCCATTTTGGTCTGCTTTATCAGCAAATTTCTTTGGTG
TTGTGATTGCTGGGCTTCTGGTGAACTTGCTTGTCAACCTTGGTCTCAAA
TATGCCATTGTTACAGGTGCTATTCTTTTCATTATATCCACCTTTATGTG
GAG
back to top