CB250302

Overview
NameCB250302
Unique NameCB250302
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length463
Libraries
Library NameType
Mature fruit abscission zone cDNA subtraction librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionEST0082 Mature fruit abscission zone cDNA subtraction library Citrus sinensis cDNA clone MFAZ112 similar to hydrolase-like protein (acc# BAB02903), mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB250302 ID=CB250302|Name=CB250302|organism=Citrus sinensis|type=EST|length=463bp
ACTGAGTAGGCGGGTAGCCACCCTGCGCAGGGTATCCTTGTTGTGGAGGA
TAGCCACCACCCGGGGGATATCCCTGCTGAGGAGGATATCCCGGTGGAGG
ATAAGCGTCCTTCGGATATCCCTCTGGAGGATAACCTTGCTGAGGGGGTG
CCCATCCTCAGTGTCCTGTTTTGCTCCTTGCAGACGCCAAATATCGGTTT
ACACCTCTCAAATTTCACTCCCAACATCTGGGTTCTTTCCTTTCAAGAGG
ATTCTTCAAGCTTGCCTTCAATCTAGTGCGCACAAAAGCTGTCGAACCTG
GTAATAAAAATAGGAGACTCAACACAAGTATCCTTATTCGTTATCCTGGG
CCATCTGGAAGGAGAAACATTTTAATAGATGCTGGCAAGTTTTTCTACCA
TAGCGCTCTTCGTTGGTTTCCTGCCTATGGGTTTGGATGATCTTCGAGAC
TGGACGAACAACG
back to top